Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • br Floating mammosphere formation assay br Viable unicellula

    2020-08-12


    Floating mammosphere formation assay
    Viable unicellular suspensions of MCF-7 and MDA-MB-231 cells were plated at 5 × 103 cells/ml in Corning ultra-low adherent 6-well culture plates in 2 ml of growth medium (SFM) including serum-free DMEM-F12 (Gibco; Thermo Fisher Scientific, Inc.), supplemented with 10 ng/ml basic fibroblast growth factor (bFGF), 20 ng/ml epidermal growth factor (EGF) and B27 (all Cyagen Biosciences, Inc., Santa Clara, CA, USA). Fresh growth medium (100 µl per well) was replenished every 2 days. The number of spheres in each well was evaluated and images of representative fields were captured after 7 days of culture. Cells grown under these conditions as non-adherent spherical clusters of cells (known as mammospheres) were enzymatically dissociated every 7 days via incubation with a 0.05% trypsin-EDTA (Gibco; Thermo Fisher Scientific, Inc.) for 2 min at 37°C. The spheres were digested and passaged to the second generation for another 7 days. Then, the third generation of tumor spheres were treated with Cisplatin and varying concentrations of curcumin respectively at 37°C in an atmosphere of 5% CO2. After 4 days, mammospheres were counted and mammosphere size was evaluated by optical imaging in the absence and presence of curcumin.
    Mammosphere differentiation assay
    After measuring sphere-forming ability, mammospheres from the differentiation assay were induced by culturing sphere-derived cells for 4 days on culture dishes in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin without growth factors (serum-supplemented medium; SSM). Three days after cell passaging, the adherent cells were collected and seeded at 5 × 103 cells/ml in Corning ultra-low adherent 6-well culture plates in SFM again. Cellular morphology, differentiation capability in the Cisplatin and curcumin groups were observed.  Phytomedicine 58 (2019) 152740
    Flow cytometry
    MCF-7 and MDA-MB-231 cells were harvested 24 h after treatment with curcumin, MCF-7 and MDA-MB-231 mammospheres were treated with curcumin for 4 days separately. All of the cells were trypsinized and collected by centrifugation, washed in 2 ml PBS and resuspended in 300 µl PBS. Each type of cell suspension (at least 1,000,000 cells/ml) were divided into 5 groups including the following: (i) blank control group; (ii) FITC mouse IgG2b kappa isotype control and PE mouse IgG2a kappa isotype control; (iii) cell suspension with FITC mouse anti-human CD44; (iv) cell suspension with PE mouse anti-human CD24; and (v) cells labeled with FITC mouse anti-human CD44 and PE mouse anti-human CD24. Cells were incubated for 20 min away from light. All of the 56-65-5 were purchased from BD Biosciences. Then cells were washed in PBS, resuspended in 200 µl PBS and analyzed on a FACSCalibur system (BD Biosciences). Unstained or single antibody-stained cells were analyzed for each group of cells.
    mRNA expression analysis
    Total RNA of cells was extracted and isolated using Trizol reagent (Ambion; Thermo Fisher Scientific, Inc.). Complementary DNA (cDNA) was synthesized from 1 mg total RNA via reverse-transcription poly-merase chain reaction (RT-PCR). Primer sequences for quantitative (q)-PCR were as follows: β-actin (forward: 5′ GTGGCCGAGGACTTTGATTG 3′; reverse: 5′ CCTGTAACAACGCATCTCATATT 3′); E-cadherin (for-ward: 5′ GAAACAGGATGGCTGAAGGTGAC 3′; reverse: 5′ TAAGCGAT GGCGGCATTGTA 3′); N-cadherin (forward: 5′ ATCCTACTGGACGGTT CGC 3′; reverse: 5′ CCTTGGCTAATGGCACTTG 3′); Vimentin (forward: 5′ TCTGGATTCACTCCCTCTGGT 3′; reverse: 5′ CGTGATGCTGAGAAG TTTCGT 3′); Fibronectin (forward: 5′ GTTATGGAGGAAGCCGAGGTT 3′; reverse: 5′ CATGGAGTCTTTAGGACGCTCA 3′); and β-catenin (for-ward: 5′ GTTATGGAGGAAGCCGAGGTT 3′; reverse: 5′ CATGGAGTCT TTAGGACGCTCA 3′). RT-qPCR using the 2X PCR master mix (Arraystar) was performed with the Gene Amp PCR System 9700. Expression of these genes in cancer cells were detected by standard fluorescent RT-qPCR assay in a ViiA 7 Real-time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The specificity of the pri-mers was confirmed from a single peak of a melting curve. Each target mRNA level was evaluated using the quantitative threshold cycle and were compared with the levels of β-actin as the internal control.
    Western blot analysis
    Whole cell lysates were prepared using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) with 1 mM phenylmethylsulfonyl fluoride (Biosharp, Anhui, China). Quantitative determination of protein concentration was performed with a Bicinchoninic Acid Protein Assay Kit (Beyotime Institute of Biotechnology). A total of 50 µg of protein samples was separated by so-dium dodecyl sulfate-polyacrylamide gel electrophoresis on a 10% dena-turing gel and were transferred to a polyvinylidene difluoride (PVDF) membrane (Immobilon®-P). Then, the PVDF membrane was blocked in 5% skimmed milk for 2 h at room temperature. TBST was used to wash the membrane. The membrane was incubated with mouse monoclonal pri-mary antibodies [Nanog (1E6C4) Mouse mAb, Oct4 (9B7) Mouse mAb, Sox2 (L73B4) Mouse mAb from Cell Signaling Technology, 1:1000] and goat anti-mouse HRP secondary antibody (Abcam, 1:2000) successively. Enhanced chemiluminescence (Beyotime Institute of Biotechnology) was applied to visualize the immunoblots. The Tanon5200 Luminescence imaging system was used to analyze the protein bands.